admin

Biology College

Infants need fat because it aids in absorption of several vitamins and also helps the ______________ to develop.nervous systemkidneysskinreproductive system

2 months ago

Solution 1

Guest #4759

2 months ago

Answer: nervous system

Infants need fat as aid in absorption of several vitamins. IT also helps the brain or the nervous system to develop normally. Fats insulate all nervous system tissues in the body. Getting enough of this help infants feel full. It is also essential for growth and development.

📚 Related Questions

Question

Match these cell cycle checkpoints to their role in genome integrity is the dna replicated with out damage?

Solution 1

Match these cell cycle checkpoints to their role in genome integrity:Is the DNA replicated with out damage?Are the chromosomes lined up correctly attached to the mitotic spindle?
Does the cell have a enough nutrients, proteins and growth factors?Is the cellular DNA badly damaged during the replication process?

G2
Is the DNA replicated with out damage?

M
Are the chromosomes lined up correctly attached to the mitotic spindle?

G1/S
Does the cell have a enough nutrients, proteins and growth factors?

Intra-S (during S-phase)
Is the cellular DNA badly damaged during the replication process?

Question

1-How does the osmolarity of the kidney interstitial fluid change from the cortex to the inner medulla? Why is this important? 2-• In the medulla, the solute concentration is high which allows water to diffuse out of the Loop of Henle through osmosis. The vasa recta capillaries are also in the medulla. How does their solute and water concentration change along the loop?

Solution 1

Osmolarity of the kidney’s interstitial fluid increases from the cortex to inner medulla. This ensures that there is a concentration gradient that allows for osmosis to take place along the kidney tubules in a kind of countercurrent flow exchange system. This way most, amount of water can be reabsorbed.

The same occurs in the loop of Henle in a process called countercurrent multiplication. The descending loop actively takes up solutes hence making the blood plasma in the the vasa recta highly concentrated. In the ascending loop, therefore, water in the tubules is reabsorbed by osmosis hence making urine more concentrated as it gets to the bladder.

Question

When westerners are asked to recall autobiographical memories, this part of their brain is activated. temporal lobe motor cortex medial frontal cortex occipital lobe?

Solution 1

The correct answer is medial frontal cortex.

Autobiographical memory is part of the explicit memory and it is a memory system which consists of episodes recollected from a person's life. It consists each person's sense of personal past history and present self. The part of the brain connected to this type of memory is the medial frontal cortex.

Question

When two pink flowers (rw) are crossed, there are four equally likely possible outcomes for the genetic makeup of the offspring: red (rr), pink (rw), pink (wr), and white (ww). complete the punnett square. if two pink flowers are crossed, what is the probability that the offspring is?

Solution 1

You get the following:
RR - red - 0.25
RW- pink - 0.50
WW- white - 0.25

So 50% chance of being pink.

Question

Paraquat is a general herbicide that kills most types of plants. in a population of ferns, it was found that 40% of the gametophytes showed resistance to paraquat (resistance is caused by a recessive allele). what is the expected frequency of resistant sporophytes in this population?\

Solution 1

I'm not 100% sure but i think the frequency be 2 resistant out of every 5 plants

Question

Suppose the correlation between height and weight for adults is +0.80. what proportion (or percent) of the variability in weight can be explained by the relationship with height?

Solution 1

Correlation is a mutual relationship or connection between two or more things. In our example a correlation of +0.80 between height and weight for adults means. A) 80%. The correlation measures the extent to which knowing the value of height helps you to predict the value of weight. Even with a high correlation of +0.80, we cannot really expect two persons with exactly the same height to have exactly the same weight. Almost always there is some difference. What this says is that, as height goes higher, the weight goes higher, too.

Question

Where are the choroid plexuses found, and what is their function?

Solution 1

It is found in the ventricles of the brain. Its function is to "The choroid plexus serves two important functions in the body. It produces cerebrospinal fluid and helps to provide a barrier, which protects the brain and other central nervous system tissue from toxins."

Question

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?

Solution 1

It would bind to the part that has a complementary sequence. Since A pairs with T and C pairs with G then it would bind to ttagc sequence on the DNA strand. The two DNA pieces would also align in anti-parallel alignment.

Question

How could UV light potentially affect an organism’s trait

Solution 1

UV light can affect the traits of organisms by changing their DNA sequence.

The DNA of organisms store the genetic information which is physically expressed as traits during gene expressions.

Also, the nucleotide sequence of DNA determines the kind of traits that will be expressed.

UV light has the capacity to alter the nucleotide sequence of DNAs, a phenomenon known as mutation.

When the DNA sequence is altered, the traits originally expressed by the DNA also become altered.

More on mutations can be found here: brainly.com/question/17106056?referrer=searchResults

Solution 2

UV light could change the DNA of the skin cells of the organism, possibly causing cancer cells to form.

Question

The cambium produces xylem toward the center of a tree and phloem toward the outside. do you think it would make any difference if the positions of the xylem and phloem were reversed? why?

Solution 1

The wood is xylem, and the bark is phloem. So, if you reverse the two, the tree is unlikely to be able to support its own weight.

What is are vascular tissues?

Vascular tissue is an intricate conducting tissue found in vascular plants that is made up of multiple cell types.

The xylem and phloem are the primary components of vascular tissue. From within, those same two tissues transport fluid as well as nutrients.

In plants, cambium is a layer of actively dividing cells that exists between xylem (wood) and phloem tissues and is responsible for the secondary growth of stems and roots.

A cambium is a tissue layer in plants that provides partially undifferentiated cells for plant growth.

It is found between the xylem and the phloem. A cambium is also a cellular plant tissue that grows phloem, xylem, or cork by division, resulting in secondary thickening.

The wood is called xylem, as well as the bark is called phloem. If the two are reversed, the tree is very unlikely to be able to endorse its own weight.

Thus, this can be the consequence of reversing the xylem and phloem.

For more details regarding vascular tissues, visit:

brainly.com/question/4522173

#SPJ2

Solution 2

Xylem is the wood and the phloem is the bark. so if you were to reverse the two the tree would likely not be able to hold up its own weight

📂 Subjects

Mathematics 2647929

History 842281

English 748681

Biology 586256

Social Studies 406852

Chemistry 368373

Business 348603

Physics 324927

Health 199835

Spanish 130075

Geography 112100

Computers and Technology 106146

Arts 77164

Advanced Placement (AP) 23675

World Languages 23213

French 22589

Engineering 19607

Law 17108

Medicine 13966

SAT 10987

German 3389

🔢 Grades

High School 3423409

Middle School 2092250

College 1518097